Arabidopsis thaliana is a green-leafed plant, but a variegated type has green-and-yellow leaves. STATE: To investigate the mechanism of plant variegation, researchers created a recessive mutation that suppresses variegation in the DNA of the variegated Arabidopsis.

Arabidopsis thaliana (A. thaliana) is a small plant from the mustard family that is used in biological research. Which of the following statement would be true of A. thaliana? Select all that apply. A. thaliana releases oxygen as a byproduct when it makes its food, glucose.

In the plant Arabidopsis thaliana, a geneticist is interested in the development of trichomes (small projections) on the leaves. A large screen turns up two mutant plants (A and B) that have no trichomes, and these mutants seem to be potentially useful in studying trichome development (if they are determined by single-gene mutations, then ...

Question: Two accessions of Arabidopsis thaliana have different phenotypes associated with flowering time. Researchers sequence several genes controlling flower time and, in one of them, find the following differences between two accessions: Sequence 1: ATCGTACGATGCTAGCTTACGTAGCATGAC Sequence 2: …

Why is Arabidopsis thaliana a good research tool? Select all that apply. It has a large, haploid genome that has been completely sequenced since 2000. Self pollination (hermaphroditic) It has prolific seed production. It is easy to cultivate The genetic and physical maps of all 5 chromosomes are not yet complete. It has a rapid life cycle.

In Arabidopsis thaliana, the Flowering Locus C (FLC) gene codes for a regulatory protein that suppresses flowering. FLC is expressed in seedlings to prevent premature flowering. In mature plants, FLC expression decreases with cooler temperatures, and flowering occurs once sufficiently cool temperatures are reached.

The figure below depicts the start of the cDNA sequence of the gene AGAMOUS from the model plant Arabidopsis thaliana. ORIGIN 1 ctasatgtactgaasaga caccagttta attaattata ottocatcat atatasctat 61 caaccaagta casactttt gtcaattete aaaatcaact ttcaccacat sattatotas 121 catatatatg ttocasaco agittaaata vaattacket teagasta catatatatt 181 aactctatet ...

Question: Phosphorous (P) is an important nutrient for plant growth. In an experiment, Arabidopsis thaliana plants grown under phosphorus‐sufficient and phosphorus‐starved conditions for six weeks were observed. At the end of six weeks it was found that the plants grown under phosphorus-starved conditions were much smaller overall.

Question: Several botanists are studying the effect of high temperature on chloroplast function in Arabidopsis thaliana, a species of flowering plant. The botanists find that extremely high temperatures damage the membrane of the chloroplasts. This causes the contents of the chloroplasts to leak into the cytosol, which makes them nonfunctional.

Question: (4pts) A vegetative storage protein (VSP2) from the model plant Arabidopsis thaliana (At) was purified as a wild-type (AtVSP2) and a recombinant protein (Nus-AtVSP2). D119E is an aspartic acid to glutamic acid substitution at amino acid position 119.